Identifikasi molekular bakteri patogen dan desain primer PCR
ABSTRACT: Management of
healthy seaweed aquaculture and control of ice ice disease are important
component in seaweed production. To support the integrated prevention of ice
ice disease, information about genetic variation of bacterial pathogen and the
availability of fast and accurate detection are required. This study aimed to
identify bacterial pathogen based on gene sequence analysis 16S-rRNA,
construction of specific PCR primer from gene sequent analysis 16S-rRNA from
bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had
the highest pathogenicity was amplificated with universal primer PCR domain
forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) and reverse primer 1387r
(5’-GGG CGG WGT GTA CAA GGC-3’). DNA Sequence obtained was compared to data
base European Bioinformatics Institute (EBI) BLASTN. Construction and
feasibility analysis of primer pair was done using primer 3 program. Two
specific primer PCR were successfully constructed namely aSEFM-F (5-
CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer
reacted optimum at 60°C and produced 201 bp amplicon.
Keywords: pathogenicity, gene
16S-rRNA, PCR, primer, specific
Penulis: Muh. Aris, Sukenda
Sukenda, Enang Harris, Muh. Fatuhcri Sukadi
Kode Jurnal: jpperikanandd130065
